silico.biotoul.fr
 

Enseignements

From silico.biotoul.fr

Revision as of 07:36, 30 August 2023 by Barriot (Talk | contribs)
Jump to: navigation, search


Contents

Licence 2 et 3 Biologie

Bioinformatique - Option L2-L3 2B2M-BCP-BBE

Emploi du temps

Aussi disponible sur https://calendar.google.com/calendar/embed?src=lic.bioinfo%40gmail.com&ctz=Europe/Paris


EDT L2-L3 2B2M-BCP-BOPE Bioinformatique
CM TD TP
semaine 02 - 09/01 13h30-15h30 en U6-404 avec R. Barriot - Bioinfo générale
semaine 03 - 16/01 13h30-15h30 en U6-404 avec F. Delavoie - Imagerie 15h45-17h45 en 4TP2-M6 avec F. Delavoie
semaine 04 - 23/01 13h30-15h30 en U6-404 avec R. Barriot - Bases de Données 15h45-17h45 en U6-404 avec R. Barriot
semaine 05 - 30/01 15h45-17h45 en 4TP2-M6 avec R. Barriot
semaine 06 - 06/02 13h30-15h30 en U6-404 avec M. Bonhomme 15h45-17h45 en U6-404 avec R. Barriot
semaine 07 - 13/02 13h30-15h30 en 4TP2-M6 avec M. Bonhomme
semaine 08 - 20/02
semaine 09 - 27/02
semaine 10 - 06/03 13h30-15h30 Contrôle Partiel
semaine 11 - 13/03 13h30-15h30 en U6-404 avec R. Barriot
semaine 12 - 20/03 13h30-15h30 en 4TP2-M6 avec R. Barriot
semaine 13 - 27/03 13h30-15h30 en U6-404 avec G. Fichant - Modélisation et Biologie des systèmes
semaine 14 - 03/04 13h30-15h30 en U2-214 avec G. Fichant 15h45-17h45 en U2-214 avec G. Fichant
semaine 15 - 10/04
semaine 16 - 17/04 13h30-15h30 Contrôle Terminal anticipé





Supports de cours

Sujets de TD/TP

L3 BCP Bioanalyse (KSVA6ABU)

2022_2023 Planning des Enseignements

Toutes les informations relatives à l'UE de Bioanalyse sont également disponibles dans l'espace dédié sur Moodle

  • Les CMs de Bioanalyse, au nombre de six, débuteront semaine 2 (9_13 Janvier 2023) sur des créneaux horaires particuliers, avec les deux premiers CMs en semaine 2. A savoir  :
       CM1 : Lundi 13H30 (CMB) Denjoy U1 et Mardi 15h45 (CMA), Denjoy U1  
       CM2 : Vendredi 10h05 (CMB) Le Chatelier 2A et Mercredi 15h45 (CMA) Denjoy U1

Les CMs suivants (CM3-CM6) auront lieu entre les semaines 3 et 6

       CM3-CM6 : vendredi 10h05 (CMB), Le Chatelier 2A et mercredi 15h45 (CMA) Denjoy U1
  • Les TPs, au nombre de cinq, se déroulent en salle informatique. Les quatre premiers TPs sont de 3h30 et le cinquième de 2h, donc attention aux horaires !

Veuillez respecter votre créneau de TP, compte tenu du nombre d'ordis par salle infos, merci

  • Fichier du Planning 2022_2023 (salles et séries)

Planning Bioanalyse CMs et TPs L3 BCP 2022_2023 (mise a jour Janv 2023)

  • Le CC aura surement lieu, le Jeudi de la semaine 8 à compter de 18h, dans un lieu restant à définir. Réservez vous le créneau horaire !



TPs en salle


Licence Pro GeBAP

Schéma de sélection et productions de semences

  • TP Analyse de QTL

L3 Biodiversité & Biologie Environementale (BEE)

Ingénierie du Végétal (KSVC5AEU)

Initiation à l'analyse de séquences biologiques


Master

Master 1 - Biotechnologies

Evolution Moléculaire (KBTD8AGU)

Supports de cours :


Support TP :


Support TD :

Master 1

Master 1 - Bioinformatique et Biologie des Systèmes + Biologie Végétale ADAM

Traitement de données biologiques (KBVX7AH1)

Supports de cours :

Supports de TD/TP :


Liens

Génétique Evolutive et Quantitative (EMBIA1GM)

Support de cours:

Supports de TD/TP :

Génomique Evolutive et Phylogénie

Supports de TD/TP :

Medicago SNPs sequences
Drosophile sequences
Primates lysozymes sequences

Master 1 - Bioinformatique parcours Biologie des Systèmes + Bioinformatique et Génomique Environnementale

Evolution Moléculaire (KBIA8ABU - KBIB8ABU)

Supports de cours :


Support TP :


Support TD :


Master 1 - Bioinformatique et Biologie des Systèmes


Bioinformatique pour la Génomique (KBIX7AB1)

Supports de cours :

Tutoriels de TP :



Mathématique pour la Biologie (KBIA7AI)

Sujets de TP :

  • TP Matrices PAM
  • TP ACP
  • TP Modélisation


Liens :

  • http://exercism.io : améliorer son niveau de programmation dans différents langages (notamment R)

Références

  • Mathématiques pour les Sciences de la vie et de la Terre – C. David, S. Mustapha, F. Viens, N. Capron, edition Dunod





Traitement de graphes et réseaux biologiques (KBIA7AD)

Supports de cours

Supports de TD/TP:

  • TP avec Roland Barriot Création de modules python (manipulation de graphes + Gene Ontology) et prise en main de igraph
  • TP5 Recherche de communautés dans les graphes


Projets 2022-23


Supports de TP (archives)

  • TP1 Visualisation et exploration de graphes
  • TP4 Librairies R - Prise en main igraph
  • TP Dessin de graphes et initiation à la librairie igraph
  • TP1-2-3 Librairie python et parcours de graphes

Liens: Logiciels

Librairies

Serveurs & Banques

Formats

Autres

Références

  • Introduction to Algorithms, Corsen, Leiserson and Rivest, MIT Press and McGraw-Hill
  • Detection of Functional Modules From Protein Interaction Networks, Pereira-Leal, Enright and Ozounis, PROTEINS: Structure, Function, and Bioinformatics, 49-57, 2004.
  • An efficient algorithm for large-scale detection of protein families, Enright, Van Dongen and Ozounis, Nucleic Acids Research, 1575-84, 2002 PMID:11917018
  • Kavosh: a new algorithm for finding network motifs, Kashani et al., BMC Bioinformatics, 2009. DOI:10.1186/1471-2105-10-318
  • Pathway discovery in metabolic networks by subgraph extraction, Faust et al., Bioinformatics, 1211-1218, 2010. DOI:10.1093/bioinformatics/btq105


Fouille de données (KBIA8AC)

Support de cours


Sujets de TD/TP sur gitlab → https://gitlab.com/rbarriot/datamining


Projet


Liens

Références

  • Data Mining: Concepts and Techniques, J. Han and M. Kamber, 2006.
  • GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists, Carmona-Saez et al., Genome Biology, 2007.
  • Petit cours d'autodéfense intellectuelle, Normand Baillargeon, 2006

Master 1 - MEEF

Sciences de la Vie (EE7BSVFM)

Supports de TD :


Master 2

Master 2P Diagnostic moléculaire en microbiolgy

Supports de cours
Tutoriels de TP

Master 2 - Bioinformatique et Biologie des Systèmes

Atelier système

Atelier Chipseq

Atelier Galaxy

UE Communication

Gestion des données non structurées et applications post-génomiques (GDNS-AP)

Se référer à l'espace moodle


Atelier Phylogénomique

Intervenants : Claire Hoede et Yves Quentin

Atelier de Phylogénomique


Biologie des Systèmes - G. Czaplicki

Fichiers avec les codes :

Biologie des Systèmes - G. Fichant

Support de cours:


TP :






Master 2 - Biologie Végétale

Biologie Computationnelle, Partie 1

Année 2023-2024

Retrouvez les supports de cours et les TPs sur le lien suivant


Documents, partie E. Gaulin




Examen 2021-2022


Partie E. Gaulin

Veuillez trouver ci-dessous, la séquence fasta de l'ADNc SSP1256 que l'on souhaite cloner dans le vecteur de destination pCAMBIA

>ADNc_SSP1256

ACTTCCAAATTCTAGTATATGTAATCCTTTT GTTCGGGTTCATGATCGAATTCCAAAGAGTGGAAAACAAGCAAAAGGTTAAATATACATG CCATTTTTGGAGCTTTCGAGCTCATAACACAGGTGAGCGCGACGAATGGATCCCTCGCTA ATAACATCATGGTCGTGGGCGCCGTCCTTGCGGCGCTCGTCGCCGGCGGGTCGTGCGGGC CCCCGAAGGTGCCACCCGGCCCCAACATCACCACCAACTACAACGGCAAGTGGCTCACCG CTAGGGCCACCTGGTACGGTCAGCCCAACGGTGCCGGCGCTCCTGACAACGGCGGTGCGT GCGGGATCAAGAACGTGAACCTGCCACCCTACAGCGGCATGACGGCGTGCGGCAACGTCC CCATCTTCAAGGACGGCAAGGGCTGCGGCTCATGCTACGAGGTGAGATGCAAGGAAAAAC CTGAGTGCTCGGGCAATCCAGTCACGGTGTACATCACTGACATGAACTACGAACCTATCG CTCCCTACCACTTCGACTTGAGCGGCAAGGCCTTCGGCTCCCTGGCAAAGCCCGGGCTCA ACGACAAGATTCGCCACTGCGGCATCATGGACGTCGAGTTCAGAAGGGTGCGATGCAAGT ACCCCGCCGGGCAGAAGATCGTGTTCCACATCGAGAAGGGCTGCAACCCCAACTACCTGG CCGTGCTGGTGAAGTATGTGGCGGACGACGGCGACATCGTGCTGATGGAAATCCAGGACA AGTTGTCGGCTGAGTGGAAGCCCATGAAGCTCTCTTGGGGCGCCATCTGGAGGATGGACA CTGCCAAGGCGCTCAAGGGCCCCTTCTCCATCCGCCTCACCAGCGAGTCCGGCAAGAAGG TCATCGCCAAAGACGTCATCCCGGCGAACTGGAGACCCGATGCCGTCTACACTTCCAACG TCCAATTTTACGTAACTTTGAATTCCCTTCGATTCATCCGGCACAGCGGGCTATGGACCT TCAGCAGCAAGCTAATTAAGTTGGCAGCATGCACCGCTAACCTTATATACTACTGAGACT TCCAAATTCTAGTATATGTAATCCTTTTGTTCGGGTTCATGATCGAATTCCAAAGAGTGG AAAACAAGCAAAAGGTTAAATATACATGCCATTTTTGGAAGCTTGGCTTTCGAGGGTACC CCTGATAGTT


Partie C. Mathé





Examen 2018-2019

Partie C. Albenne


Partie E. Gaulin

Partie C. Mathé

Partie C. Albenne





Examen 2017, partie E. Gaulin

Documents, sujet C Albenne

Examen 2016, partie E. Gaulin

Examen 2015 Documents, partie E. Gaulin


Documents, partie C. Albenne


Biologie Computationnelle (2019)

-->

Culture

  • Une histoire de tout ou presque... Bill Bryson, Payot, coll. "Petite Bibliothèque Payot" n° 851, 2012 (ISBN: 9782228907576)
  • Norman Baillargeon - Petit cours d'autodéfense intellectuelle, Éditions Lux, collection Instinct de Liberté, 2005. (ISBN: 2-895960-44-5)
  • Faire l'économie de la haine, Alain Deneault, 2018, Ecosociete Eds, coll. Polemos
  • Comment tout peut s'effondrer. Petit manuel de collapsologie à l'usage des générations présentes. 2015. Pablo Servigne, :Raphaël Stevens. seuil
  • Les sentiers de l'utopie, I. Fremeaux et J. Jordan, 2012.

F.A.Q.

  • Installation de igraph sur CentOS 6.7 en P0

Sous R, l'installation d'igraph échoue avec le protocole https, il faut donc choisir un mirroir avec le protocol http : choseCRANmirror() dernier choix (http mirrors) puis Lyon2

R> chooseCRANmirror()
R> install.packages('igraph')


  • Installation de Rstudio sur CentOS 6.7 en P0

La dernière version de Rstudio desktop ne fonctionne pas pour CentOS6.7 (nécessite des librairies plus récentes). Il faut donc télécharger et installer la version serveur :

# Dans un terminal, passer root (super-utilisateur)
bash> su
# puis les commandes ci-dessous (sans le "root>")
root> wget https://download2.rstudio.org/rstudio-server-rhel-0.99.892-x86_64.rpm
root> yum install --nogpgcheck rstudio-server-rhel-0.99.892-x86_64.rpm

Ensuite, on accède à l'interface avec le navigateur : http://localhost:8787 avec un compte de la machine (normalement le compte guest)